hren
 
TRISEDMINA TRAČERICA
Tko se razvodi? a tko staje pred oltar? Trisedma pristaje na trač stanici i vodi vas u svijet bogatih i slavnih. Tračajte zajedno s Trisemom! Budite In!

Iz novog splitskog rodilišta izašla je Fani Horvat. Po nju i sničića došli su ponosni tata Željko Kerum te Fanina majka Anita i brat Saša

Fani Horvat, djevojka Željka Keruma, napustila je danas nešto prije 12 sati splitsko rodilište u kojem je u nedjelju rodila sina splitskog gradonačelnika kojem su roditelji dali ime Frane, javlja Slobodna Dalmacija.

Pred bolnicom ih je dočekao Kerumov crni BMW  te su se uputili prema novom domu Željka i Fani Horvat na splitskim Mejama.
 
Beba splitskog gradonačelnika i mlade Fani Horvat zbog koje je, podsjetimo, prije nekoliko mjeseci napustio suprugu Ankicu, rođena je u nedjelju ujutro, a sretni tata rođenje svog trećeg djeteta slavio je do kasno u noć sa svojim društvom.


Renata Sopek uhvaćena u isprobavanju vjenčanice

Lijepu voditeljicu Renatu Sopek snimili su fotografi časopisa Extra, kojima nije htjela komentirati fotografije, no viđena je kako iz salona odlazi s jednom od vjenčanica iz čega bi se dalo naslutiti da je datum njezine svadbe sve bliži.

Extrin fotograf snimio ju je tijekom razgledavanja vjenčanica na zagrebačkoj Trešnjevci, a u modni je salon došla sa svojim kućnim ljubimcem, yorkširskom terijerkom Jinx. 
 
Na desnoj joj je ruci blistao prsten za koji svojevremeno nije htjela otkriti je li zaručnički.


Zahtjev za razvod uložio je Zoran

Zahtjev za razvod braka od supruge Vanje navodno je još prije mjesec dana podnio Zoran Mamić

Suprotno nagađanjima koja su se pojavila u medijima i tvrdnji da je Vanja Mamić podnijela zahtjev za razvod zbog suprugove nevjere s poduzetnicom Anom Šikić, navodno je upravo Zoran taj koji je poduzeo prvi korak, piše Story. 
 
Prema saznanju tjednika Story, Zoran je zahtjev za razvod zatražio prije mjesec dana na općinskom sudu u Sesvetama.
 
Zoran i Vanja u braku su 17 godina te imaju dvoje djece, 16-godišnju kćer i tri godine mlađeg sina. 

Izvor: T-portal.hr


KOMENTARI:

Stari Komentari (4)

  • (Gost)

    Toje sve ludo ,nema niko respek ni ljubav samo mani u glavi lllllllllluuuuuuuugggggggccccccciiii

    oko 10 godina prije
  • (Gost)

    šta oli dite nije moglo stat u ferarija?? :sigh

    oko 10 godina prije
  • (Gost)

    Ti misa maloga,da ne recen sta grublje,ma koje su ovo v.ijesti,ma koji su ovo novinari,ma nes ti dogadjaja za javnost,ovo je sve skupa vanka pameti

    oko 10 godina prije
  • (Gost)

    da \"docekao\" kerumov BMW, kada je auto covik i triba je jos pozdraviti,ajme ludega naroda ali u zemlji novinara i tulipana uz titule dr,mr,pr,sc su i to vrijednosti i mjerila koja se moraju naglasiti.
    DNO DNA. :grin

    oko 10 godina prije
Komentiranje je moguće smo putem facebook komentara

GLOMAZNI OTPAD
Raspored kontejnera za glomazni otpad
PRIJAVI DEPONIJ
Prijavi ilegalni deponij